Advanced Search

Vital Surveillances: Evolutionary Diversity of Coxsackievirus A6 Causing Severe Hand, Foot, and Mouth Disease — China, 2012–2023

View author affiliations
  • Abstract

    Introduction

    Coxsackievirus A6 (CVA6) has emerged as a significant pathogen responsible for severe cases of hand, foot, and mouth disease (HFMD). This study aims to delineate the demographic characteristics and analyze the viral evolution of severe HFMD associated with CVA6, thereby assisting in its surveillance and management.

    Methods

    In this investigation, 74 strains of CVA6 were isolated from samples collected from severe HFMD cases between 2012 and 2023. The VP1 gene sequences of CVA6 were amplified and analyzed to assess population historical dynamics and evolutionary characteristics using BEAST, DnaSP6, and PopART.

    Results

    A significant portion (94.4%) of severe CVA6-associated HFMD cases (51 out of 54, with 20 lacking age information) were children under 5 years old. Among the 74 CVA6 strains analyzed, 72 belonged to the D3a sub-genotype, while only two strains were D2 sub-genotype. The average genetic distance between VP1 sequences prior to 2015 was 0.027, which increased to 0.051 when compared to sequences post-2015. Historical population dynamics analysis indicated three significant population expansions of severe CVA6-associated HFMD during 2012–2013, 2013–2014, and 2019–2020, resulting in the formation of 65 distinct haplotypes. Consistent with the MCC tree findings, transitioning between regional haplotypes required multiple base substitutions, showcasing an increase in population diversity during the evolutionary process (from 14 haplotypes in 2013 to 55 haplotypes over the subsequent decade).

    Conclusions

    CVA6, associated with severe HFMD, is evolving and presents a risk of outbreak occurrence. Thus, enhanced surveillance of severe HFMD is imperative.

  • loading...
  • Funding: Supported by the Beijing Natural Science Foundation (L234052) and the National Key Research and Development Program of China (2021YFC2302003)
  • [1] Xu W, Liu CF, Yan L, Li JJ, Wang LJ, Qi Y, et al. Distribution of enteroviruses in hospitalized children with hand, foot and mouth disease and relationship between pathogens and nervous system complications. Virol J 2012;9:8. https://doi.org/10.1186/1743-422x-9-8CrossRef
    [2] Chong CY, Chan KP, Shah VA, Ng WYM, Lau G, Teo TES, et al. Hand, foot and mouth disease in Singapore: a comparison of fatal and non-fatal cases. Acta Paediatr 2003;92(10):1163-9.
    [3] Tan XJ, Huang XY, Zhu SL, Chen H, Yu QL, Wang HY, et al. The persistent circulation of enterovirus 71 in People's Republic of China: causing emerging nationwide epidemics since 2008. PLoS One 2011;6(9):e25662. https://doi.org/10.1371/journal.pone.0025662CrossRef
    [4] Xiao JB, Huang KQ, Lu HH, Song Y, Han ZZ, Zhang M, et al. Genomic epidemiology and phylodynamic analysis of enterovirus A71 reveal its transmission dynamics in Asia. Microbiol Spectr 2022;10(5):e0195822. https://doi.org/10.1128/spectrum.01958-22CrossRef
    [5] Song Y, Zhang Y, Han ZZ, Xu W, Xiao JB, Wang XJ, et al. Genetic recombination in fast-spreading coxsackievirus A6 variants: a potential role in evolution and pathogenicity. Virus Evol 2020;6(2):veaa048. https://doi.org/10.1093/ve/veaa048CrossRef
    [6] Yang F, Yuan J, Wang X, Li J, Du J, Su H, et al. Severe hand, foot, and mouth disease and coxsackievirus A6-Shenzhen, China. Clin Infect Dis 2014;59(10):1504 − 5. https://doi.org/10.1093/cid/ciu624CrossRef
    [7] Yang XH, Li YY, Zhang CB, Zhan WL, Xie J, Hu SQ, et al. Clinical features and phylogenetic analysis of severe hand-foot-and-mouth disease caused by Coxsackievirus A6. Infect Genet Evol 2020;77:104054. https://doi.org/10.1016/j.meegid.2019.104054CrossRef
    [8] Zhang Y, Hong M, Sun Q, Zhu SL, Tsewang N, Li XL, et al. Molecular typing and characterization of a new serotype of human enterovirus (EV-B111) identified in China. Virus Res 2014;183:75 − 80. https://doi.org/10.1016/j.virusres.2014.01.002CrossRef
    [9] Oberste MS, Maher K, Kilpatrick DR, Pallansch MA. Molecular evolution of the human enteroviruses: correlation of serotype with VP1 sequence and application to picornavirus classification. J Virol 1999;73(3):1941 − 8. https://doi.org/10.1128/jvi.73.3.1941-1948.1999CrossRef
    [10] Katoh K, Rozewicki J, Yamada KD. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform 2019;20(4):1160 − 6. https://doi.org/10.1093/bib/bbx108CrossRef
    [11] Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A. RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 2019;35(21):4453 − 5. https://doi.org/10.1093/bioinformatics/btz305CrossRef
    [12] Rambaut A, Lam TT, Max Carvalho L, Pybus OG. Exploring the temporal structure of heterochronous sequences using TempEst (formerly Path-O-Gen). Virus Evol 2016;2(1):vew007. https://doi.org/10.1093/ve/vew007CrossRef
    [13] Baele G, Lemey P, Bedford T, Rambaut A, Suchard MA, Alekseyenko AV. Improving the accuracy of demographic and molecular clock model comparison while accommodating phylogenetic uncertainty. Mol Biol Evol 2012;29(9):2157 − 67. https://doi.org/10.1093/molbev/mss084CrossRef
    [14] Drummond AJ, Suchard MA, Xie D, Rambaut A. Bayesian phylogenetics with BEAUti and the BEAST 1. 7. Mol Biol Evol 2012;29(8):1969 − 73. https://doi.org/10.1093/molbev/mss075CrossRef
    [15] Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, et al. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol Biol Evol 2017;34(12):3299 − 302. https://doi.org/10.1093/molbev/msx248CrossRef
  • FIGURE 1.  Molecular typing of 74 CVA6 strains isolated from severe HFMD in China, 2012–2023. The ML tree, constructed using the VP1 coding region, was utilized to determine the genotype of the CVA6 strains isolated in this study.

    Abbreviation: CVA6=Coxsackievirus A6; HFMD=hand, foot, and mouth disease; ML=maximum likelihood.

    FIGURE 2.  Inferred historical population dynamics of 74 CVA6 strains isolated from severe HFMD cases in China, 2012–2023. (A) Variation in nucleotide sequences of CVA6 from different regions. (B) Variation in nucleotide sequences of CVA6 across different years. (C) MCC tree and Bayesian skyline plot of the VP1 region of CVA6 depicting the 95% confidence intervals of the HPD analysis with light blue shading. Sequences from various regions are differentiated by color. (D) In the median-joining network, the circle size correlates with haplotype frequency, while unsampled haplotypes are shown as small black solid circles. Each connecting line indicates a mutational step between haplotypes.

    Abbreviation: CVA6=Coxsackievirus A6; HFMD=Hand, foot, and mouth disease; MCC=Maximum clade credibility; HPD=Highest posterior density.

    TABLE 1.  Summary of information on 74 cases of CVA6-associated severe hand, foot, and mouth disease in China, 2012–2023.

    Patient number Gender Age (years) Region Year Haplotype Sub-genotype NMDC number
    HFMD1 Female 1 Northwest China 2018 Hap_41 D3a NMDCN00038LF
    HFMD2 Male 1 Northwest China 2017 Hap_37 D3a NMDCN00038L8
    HFMD3 Female 2 Northwest China 2015 Hap_42 D3a NMDCN00038LI
    HFMD4 Male 4 Northwest China 2015 Hap_43 D3a NMDCN00038LJ
    HFMD5 Female 3 Northwest China 2015 Hap_29 D3a NMDCN00038JS
    HFMD6 Female 1 South China 2021 Hap_48 D3a NMDCN00038K8
    HFMD7 Male 2 South China 2023 Hap_56 D3a NMDCN00038LH
    HFMD8 Female 2 South China 2023 Hap_57 D3a NMDCN00038LN
    HFMD9 Male 2 South China 2023 Hap_58 D3a NMDCN00038LQ
    HFMD10 Male 4 South China 2020 Hap_47 D3a NMDCN00038K5
    HFMD11 Male 2 Southwest China 2022 Hap_62 D3a NMDCN00038LU
    HFMD12 Male 4 Southwest China 2022 Hap_63 D3a NMDCN00038LV
    HFMD13 Male 4 Southwest China 2022 Hap_63 D3a NMDCN00038M0
    HFMD14 Male 3 Southwest China 2022 Hap_64 D3a NMDCN00038M1
    HFMD15 Female 1 Southwest China 2022 Hap_60 D3a NMDCN00038LR
    HFMD16 Male 2 Southwest China 2022 Hap_61 D3a NMDCN00038LS
    HFMD17 Female 2 Southwest China 2020 Hap_59 D3a NMDCN00038LC
    HFMD18 Female 5 South China 2018 Hap_54 D3a NMDCN00038KS
    HFMD19 Female <1 South China 2018 Hap_55 D3a NMDCN00038KT
    HFMD20 Female 2 South China 2018 Hap_55 D3a NMDCN00038KU
    HFMD21 Male 1 South China 2018 Hap_53 D3a NMDCN00038KR
    HFMD22 Female 2 South China 2018 Hap_51 D3a NMDCN00038KM
    HFMD23 Female 1 South China 2018 Hap_52 D3a NMDCN00038KN
    HFMD24 Male 5 South China 2018 Hap_49 D3a NMDCN00038KK
    HFMD25 Male 2 South China 2018 Hap_50 D3a NMDCN00038KL
    HFMD26 Male <1 North China 2017 Hap_25 D3a NMDCN00038KO
    HFMD27 Female <1 North China 2017 Hap_26 D3a NMDCN00038KQ
    HFMD28 Male 2 North China 2017 Hap_24 D3a NMDCN00038KJ
    HFMD29 Male 1 North China 2015 Hap_23 D3a NMDCN00038K2
    HFMD30 Male 1 Central China 2019 Hap_14 D3a NMDCN00038L3
    HFMD31 Male /* Central China 2020 Hap_6 D3a NMDCN00038K3
    HFMD32 Female Central China 2020 Hap_12 D3a NMDCN00038L0
    HFMD33 Male Central China 2020 Hap_9 D3a NMDCN00038KB
    HFMD34 Male Central China 2020 Hap_10 D3a NMDCN00038KC
    HFMD35 Male Central China 2020 Hap_11 D3a NMDCN00038KP
    HFMD36 Female Central China 2020 Hap_3 D3a NMDCN00038JU
    HFMD37 Male Central China 2020 Hap_4 D3a NMDCN00038JV
    HFMD38 Male Central China 2020 Hap_5 D3a NMDCN00038K1
    HFMD39 Male Central China 2020 Hap_7 D3a NMDCN00038K4
    HFMD40 Male Central China 2020 Hap_7 D3a NMDCN00038K6
    HFMD41 Male Central China 2020 Hap_8 D3a NMDCN00038K9
    HFMD42 Male Central China 2020 Hap_1 D3a NMDCN00038JR
    HFMD43 Male Central China 2020 Hap_15 D3a NMDCN00038L4
    HFMD44 Male Central China 2020 Hap_17 D3a NMDCN00038L9
    HFMD45 Male Central China 2020 Hap_18 D3a NMDCN00038LD
    HFMD46 Male Central China 2020 Hap_19 D3a NMDCN00038LG
    HFMD47 Female Central China 2020 Hap_20 D3a NMDCN00038LK
    HFMD48 Female Central China 2020 Hap_20 D3a NMDCN00038LO
    HFMD49 Male Central China 2020 Hap_13 D3a NMDCN00038L1
    HFMD50 Female 6 Central China 2019 Hap_16 D3a NMDCN00038L6
    HFMD51 Male 4 Central China 2014 Hap_2 D3a NMDCN00038JT
    HFMD52 Male 4 East China 2017 Hap_21 D3a NMDCN00038L7
    HFMD53 Female 1 East China 2017 Hap_22 D3a NMDCN00038LT
    HFMD54 Female 3 Northwest China 2020 Hap_32 D3a NMDCN00038KE
    HFMD55 Male 4 Northwest China 2020 Hap_33 D3a NMDCN00038KF
    HFMD56 Male <1 Northwest China 2013 Hap_35 D3a NMDCN00038KH
    HFMD57 Male 1 Northwest China 2013 Hap_45 D3a NMDCN00038LM
    HFMD58 Female 3 Northwest China 2013 Hap_39 D3a NMDCN00038LB
    HFMD59 Female 1 Northwest China 2013 Hap_36 D3a NMDCN00038KI
    HFMD60 Male 1 Northwest China 2013 Hap_32 D3a NMDCN00038KD
    HFMD61 Male 1 Northwest China 2013 Hap_31 D3a NMDCN00038K7
    HFMD62 Female 1 Northwest China 2013 Hap_30 D3a NMDCN00038K0
    HFMD63 Female 2 Northwest China 2013 Hap_46 D3a NMDCN00038LP
    HFMD64 Male 1 Northwest China 2013 Hap_44 D3a NMDCN00038LL
    HFMD65 Male 1 Northwest China 2013 Hap_40 D3a NMDCN00038LE
    HFMD66 Male 2 Northwest China 2013 Hap_38 D3a NMDCN00038LA
    HFMD67 Male 1 Northwest China 2013 Hap_37 D3a NMDCN00038L5
    HFMD68 Male 2 Northwest China 2013 Hap_34 D3a NMDCN00038KG
    HFMD69 Male 1 Northwest China 2013 / D2 NMDCN00038KA
    HFMD70 Male 1 Northwest China 2013 D2 NMDCN00038L2
    HFMD71 Male 1 Northwest China 2013 Hap_27 D3a NMDCN00038JP
    HFMD72 Female 1 Northwest China 2014 Hap_36 D3a NMDCN00038KV
    HFMD73 Female 2 Northwest China 2014 Hap_28 D3a NMDCN00038JQ
    HFMD74 Male Southwest China 2021 Hap_65 D3a NMDCN00038M2
    Note: Northwest China includes Shaanxi, Gansu, and Qinghai provinces; and Ningxia Hui Autonomous Region and Xinjiang Uygur Autonomous Region. South China includes Guangdong and Hainan provinces; Guangxi Zhuang Autonomous Region; and Hong Kong SAR and Macao SAR. Southwest China includes Sichuan, Guizhou, and Yunnan provinces; Chongqing Municipality; and Xizang Autonomous Region. North China includes Hebei and Shanxi provinces; Beijing and Tianjin Municipality; and Inner Mongolia Autonomous Region. Central China includes Henan, Hubei, and Hunan provinces. East China includes Jiangsu, Zhejiang, Anhui, Fujian, Jiangxi, and Shandong provinces; Shanghai Municipality; and Taiwan, China.
    Abbreviation: HFMD=hand, foot and mouth disease; SAR=Special Administrative Region.
    * Missing age information for this case;
    No haplotype analysis of D2.
    Download: CSV

Citation:

通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索
Turn off MathJax
Article Contents

Article Metrics

Article views(2050) PDF downloads(62) Cited by()

Share

Related

Evolutionary Diversity of Coxsackievirus A6 Causing Severe Hand, Foot, and Mouth Disease — China, 2012–2023

View author affiliations

Abstract

Introduction

Coxsackievirus A6 (CVA6) has emerged as a significant pathogen responsible for severe cases of hand, foot, and mouth disease (HFMD). This study aims to delineate the demographic characteristics and analyze the viral evolution of severe HFMD associated with CVA6, thereby assisting in its surveillance and management.

Methods

In this investigation, 74 strains of CVA6 were isolated from samples collected from severe HFMD cases between 2012 and 2023. The VP1 gene sequences of CVA6 were amplified and analyzed to assess population historical dynamics and evolutionary characteristics using BEAST, DnaSP6, and PopART.

Results

A significant portion (94.4%) of severe CVA6-associated HFMD cases (51 out of 54, with 20 lacking age information) were children under 5 years old. Among the 74 CVA6 strains analyzed, 72 belonged to the D3a sub-genotype, while only two strains were D2 sub-genotype. The average genetic distance between VP1 sequences prior to 2015 was 0.027, which increased to 0.051 when compared to sequences post-2015. Historical population dynamics analysis indicated three significant population expansions of severe CVA6-associated HFMD during 2012–2013, 2013–2014, and 2019–2020, resulting in the formation of 65 distinct haplotypes. Consistent with the MCC tree findings, transitioning between regional haplotypes required multiple base substitutions, showcasing an increase in population diversity during the evolutionary process (from 14 haplotypes in 2013 to 55 haplotypes over the subsequent decade).

Conclusions

CVA6, associated with severe HFMD, is evolving and presents a risk of outbreak occurrence. Thus, enhanced surveillance of severe HFMD is imperative.

  • 1. National Key Laboratory of Intelligent Tracking and Forecasting for Infectious Diseases; World Health Organization Polio Reference Laboratory for the Western Pacific Region; Key Laboratory of Laboratory Biosafety, National Health and Key Laboratory of Laboratory Biosafety of the National Health Commission, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing, China
  • 2. Linyi Center for Disease Control and Prevention, Linyi City, Shandong Province, China
  • 3. Henan Provincial Center for Disease Control and Prevention, Zhengzhou City, Henan Province, China
  • 4. Shaanxi Provincial Center for Disease Control and Prevention, Xi’an City, Shaanxi Province, China
  • 5. Hainan Provincial Center for Disease Control and Prevention, Haikou City, Hainan Province, China
  • 6. Guizhou Provincial Center for Disease Control and Prevention, Guiyang City, Guizhou Province, China
  • 7. Gansu Provincial Center for Disease Control and Prevention, Lanzhou City, Gansu Province, China
  • 8. Guangdong Provincial Center for Disease Control and Prevention, Guangzhou City, Guangdong Province, China
  • 9. Hebei Provincial Center for Disease Control and Prevention, Shijiazhuang City, Hebei Province, China
  • 10. Hunan Provincial Center for Disease Control and Prevention, Changsha City, Hunan Province, China
  • 11. Jiangsu Provincial Center for Disease Control and Prevention, Nanjing City, Jiangsu Province, China
  • 12. Shandong Provincial Center for Disease Control and Prevention, Jinan City, Shandong Province, China
  • 13. Yunnan Provincial Center for Disease Control and Prevention, Kunming City, Yunnan Province, China
  • Corresponding author:

    Yong Zhang, yongzhang75@sina.com

  • Funding: Supported by the Beijing Natural Science Foundation (L234052) and the National Key Research and Development Program of China (2021YFC2302003)
  • Online Date: May 17 2024
    Issue Date: May 17 2024
    doi: 10.46234/ccdcw2024.086
  • Hand, foot, and mouth disease (HFMD) is a contagious disease predominantly caused by several enteroviruses and primarily affects infants and children (1). Typically characterized by fever, mouth ulcers, and rash, HFMD symptoms are often mild and generally resolve within 7–10 days. However, some individuals may develop severe symptoms such as fever, a stiff neck, shortness of breath, and worsening rash, leading to potentially life-threatening neurological, respiratory, or circulatory complications, including aseptic meningitis, encephalitis, acute flaccid paralysis, pulmonary hemorrhage, pulmonary edema, and cardiopulmonary failure (2). HFMD was classified as a notifiable disease in May 2008, identifying enterovirus A71 (EV-A71) as the predominant pathogen responsible for severe and fatal cases (3). The widespread administration of an inactivated EV-A71 vaccine in 2016 significantly decreased the incidence of EV-A71-associated HFMD cases (4). Nevertheless, the diversity of pathogens leading to severe HFMD has evolved recently due to the absence of cross-protection among different enterovirus serotypes (5). Coxsackievirus A6 (CVA6) has emerged as the primary pathogen in severe HFMD cases across various regions in China. For instance, in 2013, the Third People’s Hospital of Shenzhen reported that all eight patients with severe HFMD tested positive for CVA6, all developing meningitis, with two also suffering myocardial damage (6). Similarly, in 2017, the Guangdong Women and Children’s Hospital found that among 55 patients with CVA6-associated severe HFMD, 29 (52.7%) developed aseptic meningitis, and six (10.9%) also experienced pulmonary edema (7).

    Enteroviruses possess a single-stranded, positive-sense RNA genome that encodes both structural and nonstructural viral proteins. After entering a cell, the genomic RNA translates into a polyprotein divided into three regions: P1, P2, and P3. This polyprotein is then segmented into individual proteins by viral proteases. Specifically, the P1 region comprises four structural proteins (VP1–VP4) (8). Variations in the nucleotide sequences of the VP1 region are utilized for molecular typing of enteroviruses (9). Studies focusing on the molecular typing of CVA6 based on these sequences have identified the D3 sub-genotype as the predominant strain globally since 2008, with the D3a sub-genotype being the most widespread in China (5).

    Based on the national laboratory surveillance network for HFMD pathogens established in the Chinese mainland in 2008, a total of 74 CVA6 strains were obtained from severe HFMD cases between 2012 and 2023. Analysis of their VP1 sequences allowed for the inference of the population's historical dynamics and the evolutionary characteristics of CVA6. This study aims to provide insights into the surveillance of severe HFMD cases.

    • According to the HFMD Treatment Guidelines (2010 and 2018 editions), severe HFMD cases were defined by the following clinical signs: persistent high fever (>39 °C), neurological symptoms (depression and abnormal movement), atypical respiratory symptoms (abnormalities in respiratory rate), and circulatory dysfunction (abnormal heart rate and prolonged capillary refill time). Cases that met these criteria were included in the study, which aimed to enhance public health surveillance and informed decision-making without involving human experimentation. The study received approval from the Second Ethics Review Committee of the National Institute for Viral Disease Control and Prevention at the Chinese Center for Disease Control and Prevention.

    • According to surveillance guidelines, the local CDC collected samples (e.g., stool and throat swabs) from severe HFMD cases and transported them to designated laboratories for EVs screening using Real-time RT-PCR. All CVA6-positive samples were subsequently forwarded to the provincial CDC for virus isolation following the standard protocol (Polio Laboratory Manual, 4th ed, https://iris.who.int/handle/10665/68762). The National Polio Laboratory at the National Institute of Viral Disease Prevention and Control in China was tasked with genotype identification.

    • Nucleic acid extraction from cell cultures was carried out using the Tianlong nucleic acid extraction kit (Ex-DNA/RNA Virus (CDC)/T327, Xi’an Tianlong Technology Co., Ltd., China) and the GeneRotex 96 nucleic acid extractor (Xi’an Tianlong Technology Co., Ltd., China). The VP1 coding region was amplified through reverse transcription polymerase chain reaction (RT-PCR) utilizing the PrimeScript One Step RT-PCR kit version 2 (RR057A, TaKaRa, China). Specific primers for amplification included CVA6-2339Y (5’–3’: CCTTCTGAGGCCAACATCAT) and CVA6-3461Z (5’–3’: ATACCAAGTTGGCCCAGTCA). Sequencing was conducted using an ABI 3130 genetic analyzer (Applied Biosystems, Foster City, CA, USA), and data analysis was performed using Sequencher software (version 5.4.6, Ann Arbor, USA) to determine the VP1 coding sequence of enteroviruses. Molecular typing of sequences was completed via the enterovirus typing tool available at www.rivm.nl/mpf/enterovirus/typingtool.

    • The alignment of sequences was performed using MAFFT software (version 7.490) (10), while the best nucleotide substitution model was identified using ModelGenerator (version 0.85). RAxML-NG (version 0.9.0) was utilized to construct the maximum likelihood phylogenetic tree (11). TempEst (version 1.5) facilitated the analysis of the temporal structure of the sequences (12). The optimal molecular clock model and tree prior were determined through Path Sampling/Stepping-stone techniques (13). Bayesian phylogenetic analysis was executed using BEAST (version 1.8.4) (14), with the analysis outputs reviewed in Trace software (version 1.7.1). The Bayesian maximum clade credibility (MCC) tree was constructed using TreeAnnotator (version 1.8.4) and visualized in FigTree software (version 1.4) (http://tree.bio.ed.ac.uk/software/). A single haplotype was defined in DnaSP6 software (version 6.12.03) (15) when nucleotide sequences were identical, aiding in the understanding of nucleotide mutations throughout viral evolution. The median-joining haplotype network was built using PopART software (version 1.7).

    • This study analyzed 74 CVA6 strains isolated from severe HFMD cases, which were submitted by provincial HFMD surveillance laboratories between 2012 and 2023. Of the 74 CVA6-associated severe HFMD cases, 48 were in males and 26 in females. The patients had a median age of 2.0 years (mean age 2.05 years, range 6 months to 6.5 years). The age distribution was as follows: 25 cases in children under 1 year old, 26 cases in those aged 1–5 years, and three cases in children older than 5 years (Table 1).

      Patient number Gender Age (years) Region Year Haplotype Sub-genotype NMDC number
      HFMD1 Female 1 Northwest China 2018 Hap_41 D3a NMDCN00038LF
      HFMD2 Male 1 Northwest China 2017 Hap_37 D3a NMDCN00038L8
      HFMD3 Female 2 Northwest China 2015 Hap_42 D3a NMDCN00038LI
      HFMD4 Male 4 Northwest China 2015 Hap_43 D3a NMDCN00038LJ
      HFMD5 Female 3 Northwest China 2015 Hap_29 D3a NMDCN00038JS
      HFMD6 Female 1 South China 2021 Hap_48 D3a NMDCN00038K8
      HFMD7 Male 2 South China 2023 Hap_56 D3a NMDCN00038LH
      HFMD8 Female 2 South China 2023 Hap_57 D3a NMDCN00038LN
      HFMD9 Male 2 South China 2023 Hap_58 D3a NMDCN00038LQ
      HFMD10 Male 4 South China 2020 Hap_47 D3a NMDCN00038K5
      HFMD11 Male 2 Southwest China 2022 Hap_62 D3a NMDCN00038LU
      HFMD12 Male 4 Southwest China 2022 Hap_63 D3a NMDCN00038LV
      HFMD13 Male 4 Southwest China 2022 Hap_63 D3a NMDCN00038M0
      HFMD14 Male 3 Southwest China 2022 Hap_64 D3a NMDCN00038M1
      HFMD15 Female 1 Southwest China 2022 Hap_60 D3a NMDCN00038LR
      HFMD16 Male 2 Southwest China 2022 Hap_61 D3a NMDCN00038LS
      HFMD17 Female 2 Southwest China 2020 Hap_59 D3a NMDCN00038LC
      HFMD18 Female 5 South China 2018 Hap_54 D3a NMDCN00038KS
      HFMD19 Female <1 South China 2018 Hap_55 D3a NMDCN00038KT
      HFMD20 Female 2 South China 2018 Hap_55 D3a NMDCN00038KU
      HFMD21 Male 1 South China 2018 Hap_53 D3a NMDCN00038KR
      HFMD22 Female 2 South China 2018 Hap_51 D3a NMDCN00038KM
      HFMD23 Female 1 South China 2018 Hap_52 D3a NMDCN00038KN
      HFMD24 Male 5 South China 2018 Hap_49 D3a NMDCN00038KK
      HFMD25 Male 2 South China 2018 Hap_50 D3a NMDCN00038KL
      HFMD26 Male <1 North China 2017 Hap_25 D3a NMDCN00038KO
      HFMD27 Female <1 North China 2017 Hap_26 D3a NMDCN00038KQ
      HFMD28 Male 2 North China 2017 Hap_24 D3a NMDCN00038KJ
      HFMD29 Male 1 North China 2015 Hap_23 D3a NMDCN00038K2
      HFMD30 Male 1 Central China 2019 Hap_14 D3a NMDCN00038L3
      HFMD31 Male /* Central China 2020 Hap_6 D3a NMDCN00038K3
      HFMD32 Female Central China 2020 Hap_12 D3a NMDCN00038L0
      HFMD33 Male Central China 2020 Hap_9 D3a NMDCN00038KB
      HFMD34 Male Central China 2020 Hap_10 D3a NMDCN00038KC
      HFMD35 Male Central China 2020 Hap_11 D3a NMDCN00038KP
      HFMD36 Female Central China 2020 Hap_3 D3a NMDCN00038JU
      HFMD37 Male Central China 2020 Hap_4 D3a NMDCN00038JV
      HFMD38 Male Central China 2020 Hap_5 D3a NMDCN00038K1
      HFMD39 Male Central China 2020 Hap_7 D3a NMDCN00038K4
      HFMD40 Male Central China 2020 Hap_7 D3a NMDCN00038K6
      HFMD41 Male Central China 2020 Hap_8 D3a NMDCN00038K9
      HFMD42 Male Central China 2020 Hap_1 D3a NMDCN00038JR
      HFMD43 Male Central China 2020 Hap_15 D3a NMDCN00038L4
      HFMD44 Male Central China 2020 Hap_17 D3a NMDCN00038L9
      HFMD45 Male Central China 2020 Hap_18 D3a NMDCN00038LD
      HFMD46 Male Central China 2020 Hap_19 D3a NMDCN00038LG
      HFMD47 Female Central China 2020 Hap_20 D3a NMDCN00038LK
      HFMD48 Female Central China 2020 Hap_20 D3a NMDCN00038LO
      HFMD49 Male Central China 2020 Hap_13 D3a NMDCN00038L1
      HFMD50 Female 6 Central China 2019 Hap_16 D3a NMDCN00038L6
      HFMD51 Male 4 Central China 2014 Hap_2 D3a NMDCN00038JT
      HFMD52 Male 4 East China 2017 Hap_21 D3a NMDCN00038L7
      HFMD53 Female 1 East China 2017 Hap_22 D3a NMDCN00038LT
      HFMD54 Female 3 Northwest China 2020 Hap_32 D3a NMDCN00038KE
      HFMD55 Male 4 Northwest China 2020 Hap_33 D3a NMDCN00038KF
      HFMD56 Male <1 Northwest China 2013 Hap_35 D3a NMDCN00038KH
      HFMD57 Male 1 Northwest China 2013 Hap_45 D3a NMDCN00038LM
      HFMD58 Female 3 Northwest China 2013 Hap_39 D3a NMDCN00038LB
      HFMD59 Female 1 Northwest China 2013 Hap_36 D3a NMDCN00038KI
      HFMD60 Male 1 Northwest China 2013 Hap_32 D3a NMDCN00038KD
      HFMD61 Male 1 Northwest China 2013 Hap_31 D3a NMDCN00038K7
      HFMD62 Female 1 Northwest China 2013 Hap_30 D3a NMDCN00038K0
      HFMD63 Female 2 Northwest China 2013 Hap_46 D3a NMDCN00038LP
      HFMD64 Male 1 Northwest China 2013 Hap_44 D3a NMDCN00038LL
      HFMD65 Male 1 Northwest China 2013 Hap_40 D3a NMDCN00038LE
      HFMD66 Male 2 Northwest China 2013 Hap_38 D3a NMDCN00038LA
      HFMD67 Male 1 Northwest China 2013 Hap_37 D3a NMDCN00038L5
      HFMD68 Male 2 Northwest China 2013 Hap_34 D3a NMDCN00038KG
      HFMD69 Male 1 Northwest China 2013 / D2 NMDCN00038KA
      HFMD70 Male 1 Northwest China 2013 D2 NMDCN00038L2
      HFMD71 Male 1 Northwest China 2013 Hap_27 D3a NMDCN00038JP
      HFMD72 Female 1 Northwest China 2014 Hap_36 D3a NMDCN00038KV
      HFMD73 Female 2 Northwest China 2014 Hap_28 D3a NMDCN00038JQ
      HFMD74 Male Southwest China 2021 Hap_65 D3a NMDCN00038M2
      Note: Northwest China includes Shaanxi, Gansu, and Qinghai provinces; and Ningxia Hui Autonomous Region and Xinjiang Uygur Autonomous Region. South China includes Guangdong and Hainan provinces; Guangxi Zhuang Autonomous Region; and Hong Kong SAR and Macao SAR. Southwest China includes Sichuan, Guizhou, and Yunnan provinces; Chongqing Municipality; and Xizang Autonomous Region. North China includes Hebei and Shanxi provinces; Beijing and Tianjin Municipality; and Inner Mongolia Autonomous Region. Central China includes Henan, Hubei, and Hunan provinces. East China includes Jiangsu, Zhejiang, Anhui, Fujian, Jiangxi, and Shandong provinces; Shanghai Municipality; and Taiwan, China.
      Abbreviation: HFMD=hand, foot and mouth disease; SAR=Special Administrative Region.
      * Missing age information for this case;
      No haplotype analysis of D2.

      Table 1.  Summary of information on 74 cases of CVA6-associated severe hand, foot, and mouth disease in China, 2012–2023.

      CVA6 isolates identified in 97.3% (72/74) of cases were predominantly of the D3a sub-genotype, while the D2 sub-genotype was solely found in Northwest China (Figure 1). The cases were primarily located in Central and Western China, with the most cases reported in Northwest China (25 cases), followed by Central China (22 cases), South China (13 cases), Southwest China (8 cases), North China (4 cases), and East China (2 cases). Incidences before 2015 were predominantly in Northwest China, whereas occurrences post-2015 were mainly in Central, South, and Southwest China (Table 1).

      Figure 1. 

      Molecular typing of 74 CVA6 strains isolated from severe HFMD in China, 2012–2023. The ML tree, constructed using the VP1 coding region, was utilized to determine the genotype of the CVA6 strains isolated in this study.

      Abbreviation: CVA6=Coxsackievirus A6; HFMD=hand, foot, and mouth disease; ML=maximum likelihood.
    • The MCC tree analysis revealed that CVA6 sequences from the same geographical region displayed high similarity and often clustered together. Regarding the temporal distribution of CVA6 in severe HFMD cases, sampling in Northwest China was primarily conducted before 2015. In contrast, post-2015 samples predominantly came from patients with severe HFMD in Central, South, and Southwest China. The evolutionary distances between post-2015 sequences and those isolated earlier in Northwest China significantly increased. Specifically, the average genetic distance was 0.027 for sequences before 2015 and increased to 0.051 for sequences post-2015 compared to earlier sequences (Figure 2A). Within the same region, the average genetic distance among sequences was 0.032, whereas it was 0.044 between different regions (Figure 2B). Furthermore, Bayesian skyline plot analysis indicated that the D3a sub-genotype of CVA6, isolated from 72 cases, experienced three population expansions during its evolutionary history, specifically in 2012–2013, 2013–2014, and 2019–2020. Notably, there were significant increases in the population size during the periods 2012–2013 and 2019–2020 (Figure 2C).

      Figure 2. 

      Inferred historical population dynamics of 74 CVA6 strains isolated from severe HFMD cases in China, 2012–2023. (A) Variation in nucleotide sequences of CVA6 from different regions. (B) Variation in nucleotide sequences of CVA6 across different years. (C) MCC tree and Bayesian skyline plot of the VP1 region of CVA6 depicting the 95% confidence intervals of the HPD analysis with light blue shading. Sequences from various regions are differentiated by color. (D) In the median-joining network, the circle size correlates with haplotype frequency, while unsampled haplotypes are shown as small black solid circles. Each connecting line indicates a mutational step between haplotypes.

      Abbreviation: CVA6=Coxsackievirus A6; HFMD=Hand, foot, and mouth disease; MCC=Maximum clade credibility; HPD=Highest posterior density.

      Analysis of the 72 CVA6 D3a VP1 sequences identified 258 variable sites within the 915 bp fragment, encompassing 65 haplotypes. In 2013, there were 14 haplotypes, with 41 additional haplotypes emerging over the subsequent decade. Of the 65 haplotypes, 58 (89.2%, 58/65) comprised solely a single sequence. These haplotypes were distributed across various regions, forming several large clusters of regionally originated haplotypes in the haplotype network plot and the MCC tree. This clustering indicates that haplotypes from different regions diverged through multiple base substitutions. The analyses also imply the existence of further undetected samples, as evidenced in Figure 2D and Table 1.

    • Unlike mild HFMD, severe cases can lead to neurological, respiratory, or circulatory complications, and treatment delays may result in further deterioration. EV-A71 has been identified as the predominant pathogen responsible for severe HFMD. However, following the introduction of the inactivated EV-A71 vaccine in 2016, the spectrum of pathogens causing HFMD has shifted, with other enteroviruses, particularly CVA6, emerging as the primary causative agents (5).

      Seventy-four cases of severe HFMD associated with CVA6 were reported in children under the age of 5 years. The immature immune systems of this age group may heighten their susceptibility, leading to severe complications and potentially fatal outcomes if not promptly diagnosed and treated (2). Consequently, the development and administration of vaccines targeting CVA6 are crucial to prevent severe HFMD in susceptible children.

      The CVA6 genotype, particularly the dominant D3a sub-genotype in China, has been isolated primarily, with only two instances of the D2 strain identified in 2013. This underscores the necessity for ongoing robust surveillance of severe HFMD specifically targeting the CVA6 D3a sub-genotype. In this study, a total of 74 CVA6 strains were collected from severe HFMD cases between 2012 and 2023, predominantly in Central China, Northwest China, and South China. It is important to note that the limited number of samples and the considerable variability in surveillance quality across provinces may introduce bias in the analysis, potentially skewing the true prevalence of CVA6-associated severe HFMD.

      D3a has been the predominant sub-genotype of CVA6 in China since 2012. Population dynamic analyses reveal that the virus isolated from severe HFMD cases exhibited three major expansions, reflecting increased diversity within the CVA6 population post-2012. Haplotype reconstruction from 74 sequences identified 65 unique haplotypes, underscoring the extensive diversity among CVA6 strains associated with severe HFMD across different regions. Notably, no shared haplotypes were found between regions, suggesting the existence of undetected haplotypes and potentially unmonitored severe HFMD cases associated with CVA6. Current diagnostic criteria for severe HFMD, which include mild clinical symptoms with neurological or circulatory complications (2), may lead to misdiagnoses, such as enteroviral meningitis, thus contributing to the underreporting of severe HFMD cases. Given these findings, enhancing surveillance and improving clinician training on the identification and reporting of severe HFMD is essential to better assess and manage the disease burden.

    • No conflicts of interest.

    • The staff of the local Centers for Disease Control and Prevention in Gansu, Guangdong, Guizhou, Hainan, Hebei, Henan, Hunan, Jiangsu, Shandong, Shaanxi, Sichuan, Yunnan, Zhejiang, and Chongqing PLADs for their efforts in collecting the clinical samples.

Reference (15)

Citation:

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return