Methods and Applications: Establishment of a Lateral Flow Dipstick Detection Method for Influenza A Virus Based on CRISPR/Cas12a System

The M gene sequences from 126 IAVs, encompassing various subtypes such as H3N2, H1N1, H1N2, H5N1, H5N6, H5N8, H7N7, H7N9, H9N2, H10N3, among others, were retrieved from the NCBI GenBank database and analyzed individually. Sequence alignment was conducted using VectorNTI software, focusing on identifying highly homologous conserved sequences while avoiding the formation of secondary and hairpin structures. To target these conserved regions, multiple sets of primers and probes were designed using Primer 5 software and assessed with Oligo software, incorporating degenerate bases to accommodate variations among sequences. Specifically, the M gene of the H3N2 subtype (GenBank: OR865615.1) was utilized to design three sets of primers for both forward and reverse orientations, as detailed in Table 1. Additionally, for crRNA design, the reverse 20 nucleotide segment of the PAM sequence (TTTN or AAAN) was selected from the amplified targets, with a backbone sequence of UAAUUUCUACUAAGUGUAGAU, also listed in Table 1. The synthesis of all primers and crRNA sequences was performed by Shanghai Sangong Biotechnology.

The M gene was cloned into the pUC57 plasmid vector, and the synthesis was carried out by Shanghai Sangong Biotechnology. To amplify the cloned plasmid containing the target gene, three pairs of primers were utilized. The optimal primer pairs were determined through PCR. The composition of the PCR mixture was as follows: 25 µL of 2×EasyTaq® PCR SuperMix, 1 µL of 10 µmol/L forward primer, 1 µL of 10 µmol/L reverse primer, 2 µL of template DNA, and 21 µL of nuclease-free water (Supplementary Material). The PCR conditions included an initial denaturation at 94 °C for 30 seconds; followed by 40 cycles of 94 °C for 30 seconds, 58 °C for 15 seconds, and 72 °C for 10 seconds. The PCR products were analyzed using agarose gel electrophoresis, employing 2 µL of the PCR products for analysis; the electrophoresis was conducted at 120 V for 40 minutes.

The CRISPR/Cas12a reaction setup was as follows: the reaction mixture contained 2 µL of 10x NEB buffer, 2 µL of 500 nmol/L crRNA, 2 µL of 500 nmol/L Cas12a, and 11 µL of nuclease-free water. This mixture was incubated at 25 °C for 10 min. Subsequently, 1 µL of ssDNA-LFD probe (10 µmol/L, 5’-FAM-AAAAAAAA-Bio-3’) and 2 µL of PCR products were added. The mixture was thoroughly mixed by shaking, followed by centrifugation, and then incubated in a 37 °C water bath for an additional 10 minutes. After the incubation, an LFD was inserted into the reaction tube, and results were typically observed within 5–10 minutes. The reactions were conducted separately using crRNA-1 and crRNA-2 to determine the more effective crRNA, as indicated by the intensity of the test strip’s color.

The plasmid encoding the M gene template was synthesized following the previously mentioned procedures. Nucleic acid concentrations were measured using a Qubit 2.0 fluorometer, and the copy number was calculated using the formula: Concentration (copies/μL) = [(6.02 × 10²³) × Concentration (ng/μL) × 10⁻⁹] / [DNA length (bp) × 660]. The plasmid was serially diluted in tenfold increments from 10⁷ to 10⁰ copies/μL. PCR reactions utilized these varying concentrations of plasmids as templates and were analyzed through qPCR and CRISPR/Cas12a diagnostic strips. For each dilution level, 2 μL of the sample was added to the reaction mix, with eight replicates conducted for each dilution.

Nucleic acids from positive samples of common respiratory viruses, including IBV, RSV, HRV, MP, HAdV, and 2019-nCoV, were detected using the established PCR-CRISPR/Cas12-LFD method. Additionally, the specificity of this method was analyzed.

Fifty-six IAV-positive clinical samples, along with 26 negative controls, underwent nucleic acid extraction followed by reverse transcription using the specified reagents: 4 µL of 5×ES RT Buffer, 1 µL of Total RNA, 1 µL of 10 mmol/L dNTPs, 1 µL of Anchored Oligo(dT)₁₈ Primer, 1 µL of EasyScript^®, and 12 µL of nuclease-free water. The reverse transcription conditions were set at 42 ℃ for 30 minutes. Subsequently, the samples were analyzed using PCR-CRISPR/Cas12-LFD and fluorescent PCR methods. The concordance between these two methods was then assessed using kappa statistics.

The plasmid was identified utilizing three primer pairs and two crRNAs targeting the M gene, with results in Figure 2. All primer pairs successfully amplified the target gene. The two crRNAs detected the amplification products. Notably, the F2R2 primer exhibited higher amplification efficiency compared to the other pairs (Figure 2A), and crRNA-2 produced the most robust signal (Figure 2B). Consequently, F2R2 and crRNA-2 were chosen to develop the PCR-CRISPR/Cas12-LFD method.

Figure 2. 

Establishment of the PCR-CRISPR/Cas12-LFD Detection Method. (A) Electrophoretic analysis of PCR products with three primer pairs; (B) CRISPR RNA (crRNA) selection using the LFD method.

Note: Panel A, 1–3: three replicated amplicons obtained with F1R1 primers; 4–6: three replicated amplicons using F2R2 primers; 7–9: three replicated amplicons generated by F3R3 primers. Panel B, 1–2: two replicates tested with crRNA-1; 3–4: two replicates tested with crRNA-2.

Abbreviation: LFD=lateral flow dipstick; crRNA= CRISPER RNA.

The M gene of IAV underwent further sensitivity analysis and reproducibility evaluation. Eight dilution gradients from 10⁷ to 10⁰ were established, and detection utilized both the qPCR and the PCR-CRISPR/Cas12-LFD method. The detection limit for the PCR-CRISPR/Cas12-LFD method was identified as 10 copies/μL. Repeated experiments (eight repetitions per dilution) demonstrated consistent results, affirming the method’s superior stability (Figure 3).

Figure 3. 

Sensitivity analysis of PCR-CRISPR/Cas12-LFD for the detection of IAV. (A) Sensitivity of qPCR in detecting IAV, with three replicates for each of eight dilutions ranging from 10⁷ to 10⁰; (B) Sensitivity of PCR-CRISPR/Cas12-LFD in detecting IAV, with eight dilutions from 10⁷ to 10⁰.

Abbreviation: LFD=lateral flow dipstick; IAV=influenza A virus.

This study established a PCR-CRISPR/Cas12-LFD method that successfully detected twenty-six common respiratory viruses, including IBV, RSV, HRV, MP, HAdV, and 2019-nCoV, without any false positive results, demonstrating the method’s high specificity.

The practicality of the PCR-CRISPR/Cas12-LFD method developed in this study was assessed using 82 clinical samples, including 56 IAV-positive and 26 IAV-negative samples identified by qPCR. For comparative purposes, the Universal Nucleic Acid Detection Kit for Influenza A Virus from SunSure Biotechnology was used as a control. Results indicated a kappa coefficient of 0.95 between the two methods, indicating identical performance (Table 2).

Data show that between November 15, 2023, and December 30, 2023, the incidence of IFV infection among outpatients exhibiting respiratory symptoms in North China, particularly in the Beijing area, ranged from 20% to 50%. Influenza is expected to continue its prevalence across different regions, potentially leading to localized outbreaks. It is anticipated that the IAV, specifically strains H3N2 and H1N1, will remain predominant in these pandemic occurrences (https://www.nmdc.cn/). Concurrently, other respiratory pathogens such as RSV and mycoplasma infections are also imposing significant public health challenges (10-11). Accurate and fast identification of these pathogens is crucial for effective disease prevention and control.

The CRISPR/Cas system, renowned for its high precision and ease of use, has evolved swiftly into an effective tool for pathogen detection (12). Initial research primarily concentrated on the CRISPR/Cas9 system, yet the inherent limitations associated with the Cas9 protein, such as its size, have restricted broader applications of this technology (13). Recently, the CRISPR/Cas12 system, also known as CRISPR/Cpf1, has emerged as a focal area of interest. This system falls under the V type category and includes Cas proteins ranging from Cas12a to Cas12e, with Cas12a being more extensively utilized in nucleic acid detection. This interaction activates the RuvC structural domain of the protein for DNA cleavage and initiates trans-cleavage activity, a distinct feature of the CRISPR/Cas12 system (14−15). The CRISPR/Cas12 system offers advantages such as increased reaction speed, lower off-target rates, and higher editing efficiency, making it particularly suitable for the precise identification of pathogens (16). Moreover, leveraging the trans-cleavage activity of Cas proteins, CRISPR-Cas has been integrated with photoelectrochemical biosensors for high-throughput detection (17). Additionally, the high sensitivity of the CRISPR-Cas system allows for the direct detection of pathogens using electrochemical methods without the need for nucleic acid amplification (18).

LFD has become a commonly employed technique for nucleic acid detection due to its rapidity, convenience, and cost-effectiveness (19). In our study, we utilized double-antibody sandwich immunochromatography for the swift identification of nucleic acid amplification products. The front end of the test strip was pre-coated with a mixture of FAM antibody and gold nanoparticles, the control line with a secondary antibody to the FAM antibody, and the test line with a biotin antibody. We labeled the ends of the probe with FAM and biotin, respectively. Upon activation of Casase’s cutting activity, colorful precipitates were observed at both the detection and quality control lines. In the absence of probe cleavage, a precipitate formed only at the quality control line. This reaction with the amplified product allows for visual results within 2–10 minutes (20). Due to the lower cost of traditional PCR combined with LFD compared to fluorescence quantitative PCR, it is especially favored in primary-level laboratories and field detection.

The CRISPR/Cas12 system holds promise as a diagnostic tool for pathogen detection (21-23). Recent advancements have incorporated isothermal detection combined with CRISPR and test strips to identify IFA and other prevalent pathogens. However, these methods face challenges, such as the need for 30–35 bp primers in recombinase polymerase amplification (RPA) and 4–6 pairs of primers in Loop-mediated isothermal amplification (LAMP), complicating primer design. This complexity can lead to mismatches and false-positive results, thereby reducing specificity (24). In contrast, PCR remains a traditional method with advantages including lower costs for instruments and reagents, along with enhanced sensitivity and specificity. The integration of PCR, CRISPR-Cas12a, and LFD offers superior sensitivity and specificity, making it particularly suitable for local primary laboratories.

Challenges to this combined detection include less sensitivity than qPCR, and requirement for integrated microfluidics for portability, in which we will develop further.

In this study, we developed a rapid diagnostic method for detecting IAV that integrates the benefits of PCR, CRISPR/Cas12, and LFD techniques. This method exhibits high sensitivity and specificity while eliminating the need for fluorescent PCR instruments and allowing for visual interpretation of results. When testing a positive plasmid containing the M gene, the method achieved a sensitivity of 10 copies/μL. We evaluated the method on 82 clinical samples, and it demonstrated a high degree of consistency with real-time fluorescence PCR, except for two samples not detected with a qPCR CT value exceeding 35. Tests on various common respiratory samples indicated no cross-reactivity, confirming the method’s high specificity. Furthermore, this study innovatively detects different subtypes of IAV by including degenerate bases in the primer design and conducts optimized screening of crRNA to enhance both sensitivity and specificity of the detection process.