Advanced Search

Preplanned Studies: Sequencing the Complete Genome of COVID-19 Virus from Clinical Samples Using the Sanger Method

View author affiliation
  • Summary

    What is already known on this topic?

    Coronavirus disease 2019 (COVID-19), a disease caused by a novel human coronavirus named the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or COVID-19 virus, was reported in December 2019. Complete genomes of the COVID-19 virus from clinical samples using next generation sequencing (NGS) have been reported.

    What is added by this report?

    Here we provide the technical data for sequencing complete genome of COVID-19 virus from clinical samples using the Sanger method. Two complete COVID-19 virus genome sequences (named WH19004-S and GX0002) were obtained from clinical samples of COVID-19 patients, and two single nucleotide polymorphisms (SNPs) in ORF7a (T/C, nt 27,493) and ORF8 (T/C, nt 28,253) of WH19004-S were identified by Sanger sequencing.

    What are the implications for public health practice?

    The COVID-19 virus genome sequencing by Sanger method reported here could be used to generate data of high enough quality without requirement for expensive NGS equipment, which support sequencing complete genomes from clinical samples and monitoring of viral genetic variations of COVID-19 infections.

  • loading...
  • [1] Wang C, Horby PW, Hayden FG, Gao GF. A novel coronavirus outbreak of global health concern. Lancet 2020;3(10223):470 − 3.
    [2] Tan WJ, Zhao X, Ma XJ, Wang WL, Niu PH, XU WB, et al. Notes from the field: a novel coronavirus genome identified in a cluster of pneumonia cases-Wuhan, China 2019−2020. China CDC Weekly 2020; 2(4): 61-2.
    [3] Zhu N, Zhang DY, Wang WL, Li XW, Yang B, Song JD, et al. A novel coronavirus from patients with pneumonia in China, 2019. N Engl J Med 2020;3(8):727 − 33.
    [4] Huang CL, Wang YM, Li XW, Ren LL, Zhao JP, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020;3(10223):15 − 21.
    [5] Coronaviridae Study Group of the International Committee on Taxonomy of Viruses. The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2. Nat Microbiol 2020;3(4):536 − 44.
    [6] Su S, Wong G, Shi WF, Liu J, Lai ACK, Zhou JY, et al. Epidemiology, genetic recombination, and pathogenesis of coronaviruses. Trends Microbiol 2016;3(6):490 − 502.
    [7] Lu RJ, Zhao X, Li J, Niu PH, Yang B, Wu HL, et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet 2020;3(10224):565 − 74.
    [8] Quiñ ones-Mateu ME, Avila S, Reyes-Teran G, Martinez MA, et al. Deep sequencing: becoming a critical tool in clinical virology. J Clin Virol 2014;3(1):9 − 19.
    [9] Tewhey R, Bansal V, Torkamani A, Topol EJ, Schork NJ, et al. The importance of phase information for human genomics. Nat Rev Genet 2011;3(3):215 − 23.
    [10] Mu WB, Lu HM, Chen J, Li SW, Elliott AM. Sanger confirmation is required to achieve optimal sensitivity and specificity in next-generation sequencing panel testing. J Mol Diagn 2016;3(6):923 − 32.
  • FIGURE 1.  COVID-19 virus genome fragment amplification by RT-PCR. A: Schematic representation of the amplificatory fragments of the genome. B: Capillary electrophoresis profiles of RT-PCR products of the obtained partial fragment. a to k: RT-PCR products of the fragment 1–11; l to m: RT-PCR products of the end of 5’ and 3’ of the genome.

    FIGURE 2.  Sequence comparison and Sanger sequencing diagram of COVID-19 virus in this study. (A) Sequence alignment of 4 whole-length genomes of COVID-19 virus. (B) Sanger sequencing diagram of WH19004-S by reverse primers 29R and 30R, which shows the SNPs in ORF7 and ORF8 of WH19004-S.

    TABLE 1.  Primers used for whole-genome sequencing of the COVID-19 virus.

    Set Name Start* End* Primer sequence (5’→3’)
    12 12F 8,966 8,986 AAACTTATAGAGTACACTGAC
    12R 10,166 10,185 CAGATCACATGTCTTGGACA
    13R 11,114 11,133 GCAGACATAGCAATAATACC
    14 14F 10,901 10,922 GGTAGTGCTTTATTAGAAGATG
    15 15F 12,024 12,043 CCATGCAGGGTGCTGTAGAC
    16 16F 12,970 12,991 CAACCTAAATAGAGGTATGGTA
    17 17F 13,775 13,795 CACATATATCACGTCAACGTC
    18 18F 14,756 14,777 ACTTCTTCTTTGCTCAGGATGG
    19 19F 15,929 15,850 GCAAAATGTTGGACTGAGACTG
    20 20F 16,832 16,853 CCTTTGAAAAAGGTGACTATGG
    21 21F 17,530 17,549 ATAGGTCCAGACATGTTCCT
    22 22F 18,487 18,506 ATACCACTTATGTACAAAGG
    23 23F 19,438 19,459 CCACTAAAGTCTGCTACGTGTA
    24 24F 20,363 20,384 TACATCTACTGATTGGACTAGC
    25 25F 19,828 19,850 AAAATACTCAATAATTTGGGTGT
    26 26F 20,428 20,447 CCTATGGACAGTACAGTTAA
    26R 21,665 21,684 TTGTCAGGGTAATAAACACC
    27 27F 21,332 21,354 ATGCAAATTACATATTTTGGAGG
    28 28F 22,433 22,449 TGTGCACTTGACCCTCT
    28R 23,345 23,364 CCTGGTGTTATAACACTGAC
    29 29F 23,123 23,142 CCAGCAACTGTTTGTGGACC
    30 30F 23,339 23,360 GGTGGTGTCAGTGTTATAACAC
    31R 25,157 25,176 TTTCCAAGTTCTTGGAGATC
    32 32F 24,960 24,981 TCAACAACACAGTTTATGATCC
    33 33F 25,837 25,857 TGGCATACTAATTGTTAYGAC
    33R 27,033 27,052 GAAAGCGTTCGTGATGTAGC
    34 34F 26,815 26,834 CTTCTTTCAGACTGTTTGCG
    35 35F 27,389 27,406 CGAACATGAAAATTATTC
    35R 28,550 28,568 CGTCACCACCACGAATTCG
    36 36F 28,322 28,341 TTTGGTGGACCCTCAGATTC
    36R 29,543 29,561 CCATCTGCCTTGTGTGGTC
    37 37F 29,149 29,170 CAGACAAGGAACTGATTACAAA
    38 38F 26,539 26,559 GTACTATTACCGTTGAAGAGC
    * The location on the reference genome, accession ID: EPI_ISL_402120.
    Download: CSV


通讯作者: 陈斌,
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索
Turn off MathJax
Article Contents

Article Metrics

Article views(19604) PDF downloads(405) Cited by()



Sequencing the Complete Genome of COVID-19 Virus from Clinical Samples Using the Sanger Method

View author affiliation


What is already known on this topic?

Coronavirus disease 2019 (COVID-19), a disease caused by a novel human coronavirus named the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or COVID-19 virus, was reported in December 2019. Complete genomes of the COVID-19 virus from clinical samples using next generation sequencing (NGS) have been reported.

What is added by this report?

Here we provide the technical data for sequencing complete genome of COVID-19 virus from clinical samples using the Sanger method. Two complete COVID-19 virus genome sequences (named WH19004-S and GX0002) were obtained from clinical samples of COVID-19 patients, and two single nucleotide polymorphisms (SNPs) in ORF7a (T/C, nt 27,493) and ORF8 (T/C, nt 28,253) of WH19004-S were identified by Sanger sequencing.

What are the implications for public health practice?

The COVID-19 virus genome sequencing by Sanger method reported here could be used to generate data of high enough quality without requirement for expensive NGS equipment, which support sequencing complete genomes from clinical samples and monitoring of viral genetic variations of COVID-19 infections.

  • 1. Key Laboratory of Biosafety, National Health and Family Planning Commission, National Institute for Viral Disease Control and Prevention, China CDC, Beijing, China
  • Corresponding author:

    Wenjie Tan,

    Online Date: May 08 2020
    doi: 10.46234/ccdcw2020.088
  • In December 2019, a novel coronavirus from patients with pneumonia was identified and subsequently named the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (1-3). SARS-CoV-2 has caused a coronavirus disease 2019 (COVID-19) pandemic with high morbidity and mortality. Analyzing the genome of SARS-CoV-2 (also referred to as COVID-19 virus) from clinical samples is crucial for the understanding of viral spread and viral evolution as well as for vaccine development (4-6). Presently, whole genome sequencing of the COVID-19 virus was often generated by next generation sequencing (NGS) (7). Although NGS methods have many advantages in terms of speed and parallelism, the accuracy and read length of Sanger sequencing is still superior and has confined the use of NGS mainly to resequencing genomes (8).

    Here we introduce a detailed method to rapidly obtain COVID-19 virus whole-genome sequence from clinical samples. This method is based on multiple nucleic acid amplified fragments for Sanger sequencing. We applied this method to obtain 2 complete genome sequences of COVID-19 virus from clinical samples of patients with COVID-19.

    • In this study, bronco-alveolar lavage samples were collected from patients with COVID-19 in Hubei, China. COVID-19 virus RNA was identified as positive (Ct value: 28.78 and 31.86) by a real-time fluorescence-based reverse transcriptase polymerase chain reaction (rRT-PCR) assay as previously reported (7).

    • Viral RNA was extracted from 140 μL of sample using QIAamp Viral mini kits (Qiagen, Germany) according to the manufacturer’s instructions. RNA was eluted in 80 μL of elution buffer. A total of 38 sets of specific primers covering the whole COVID-19 virus genome were designed (Table 1) according to the reference sequence (WH19004, Accession ID: EPI_ISL_402120) obtained by NGS as previously reported (7). Overlapping fragments were obtained by RT-PCR conducted as follow: 5 μL of extracted RNA were amplified with the QIAGEN OneStep RT-PCR Kit (Qiagen, Germany) and RT-PCR programs were run as follows: 50 ℃ 30 min; 95 ℃ for 15 min; 95 ℃ for 30 s, 50/55 ℃ 30 s, 72 ℃1/2 min, 40 cycles; 72 ℃ 5 min. All PCR products were confirmed by gel electrophoresis analysis and sequenced using the Sanger method.

      Set Name Start* End* Primer sequence (5’→3’)
      6 6F 2,846 2,865 ACAGTTGAACTCGGTACAGA
      7 7F 3,884 3,904 CCTAAAGAGGAAGTTAAGCCA
      8 8F  4,787 4,807 GCTGGTTCCTATAAAGATTGG
      8R  6,146 6,165 ACATCACCATTTAAGTCAGG
      10 10F 6,977 6,999 GTTTGCCTAGGTTCTTTAATCTA
      11 11F 7,985 8,006 CAGGCATTAGTGTCTGATGTTG
      12 12F 8,966 8,986 AAACTTATAGAGTACACTGAC
      12R 10,166 10,185 CAGATCACATGTCTTGGACA
      13 13F 9,900 9,921 ATAAGTACAAGTATTTTAGTGG
      13R 11,114 11,133 GCAGACATAGCAATAATACC
      14 14F 10,901 10,922 GGTAGTGCTTTATTAGAAGATG
      14R 12,175 12,196 AAGAACAACTTCAGAATCACCA
      15 15F 12,024 12,043 CCATGCAGGGTGCTGTAGAC
      15R 13,205 13,225 GGATTCTTGATCCATATTGGC
      16 16F 12,970 12,991 CAACCTAAATAGAGGTATGGTA
      17 17F 13,775 13,795 CACATATATCACGTCAACGTC
      17R 14,999 15,019 GTGCATCTTGATCCTCATAAC
      18 18F 14,756 14,777 ACTTCTTCTTTGCTCAGGATGG
      19 19F 15,929 15,850 GCAAAATGTTGGACTGAGACTG
      20 20F 16,832 16,853 CCTTTGAAAAAGGTGACTATGG
      20R 17,956 17,977 GGTCTCTATCAGACATTATGCA
      21 21F 17,530 17,549 ATAGGTCCAGACATGTTCCT
      21R 18,781 18,801 TTGTAGGTTACCTGTAAAACC
      22 22F 18,487 18,506 ATACCACTTATGTACAAAGG
      22R 19,618 19,639 AAGCCACATTTTCTAAACTCTG
      23 23F 19,438 19,459 CCACTAAAGTCTGCTACGTGTA
      23R 20,568 20,589 GTCAATAGTCACTTTGACAACC
      24 24F 20,363 20,384 TACATCTACTGATTGGACTAGC
      24R 21,658 21,678 GGGTAATAAACACCACGTGTG
      25 25F 19,828 19,850 AAAATACTCAATAATTTGGGTGT
      26 26F 20,428 20,447 CCTATGGACAGTACAGTTAA
      26R 21,665 21,684 TTGTCAGGGTAATAAACACC
      27 27F 21,332 21,354 ATGCAAATTACATATTTTGGAGG
      27R 22,539 22,560 GTAATATTAGGAAATCTAACAA
      28 28F 22,433 22,449 TGTGCACTTGACCCTCT
      28R 23,345 23,364 CCTGGTGTTATAACACTGAC
      29 29F 23,123 23,142 CCAGCAACTGTTTGTGGACC
      29R 24,095 24,116 CACAAATGAGGTCTCTAGCAGC
      30 30F 23,339 23,360 GGTGGTGTCAGTGTTATAACAC
      30R 24,328 24,349 ACTATTAAATTGGTTGGCAATC
      31 31F 23,948 23,971 GATTTTGGTGGTTTTAATTTTTCA
      31R 25,157 25,176 TTTCCAAGTTCTTGGAGATC
      32 32F 24,960 24,981 TCAACAACACAGTTTATGATCC
      32R  26,171 26,192 GGTTCATCATAAATTGGTTCCA
      33 33F 25,837 25,857 TGGCATACTAATTGTTAYGAC
      33R 27,033 27,052 GAAAGCGTTCGTGATGTAGC
      34 34F 26,815 26,834 CTTCTTTCAGACTGTTTGCG
      34R 27,948 27,968 ACATGACTGTAAACTACATTC
      35 35F 27,389 27,406 CGAACATGAAAATTATTC
      35R 28,550 28,568 CGTCACCACCACGAATTCG
      36 36F 28,322 28,341 TTTGGTGGACCCTCAGATTC
      36R 29,543 29,561 CCATCTGCCTTGTGTGGTC
      37 37F 29,149 29,170 CAGACAAGGAACTGATTACAAA
      37R 29,836 29,857 GAAGCTATTAAAATCACATGGG
      38 38F 26,539 26,559 GTACTATTACCGTTGAAGAGC
      38R 27,102 27,122 CCTGTAGCGACTGTATGCAGC
      3′-RACE 41F 29,149 29,170 CAGACAAGGAACTGATTACAAA
      42F 29,438 29,459 CAGCAAACTGTGACTCTTCTTC
      * The location on the reference genome, accession ID: EPI_ISL_402120.

      Table 1.  Primers used for whole-genome sequencing of the COVID-19 virus.

    • The 5’ and 3’ ends of the genome were determined by rapid amplification of cDNA ends (RACE) using the Invitrogen 5’ RACE System and 3’ RACE System (Invitrogen, USA) according to the manufacturer’s instructions. Gene-specific primers for 5’ and 3’ RACE PCR amplification were designed to obtain a fragment of approximately 400–500 bp for the two regions. Purified PCR products were cloned into the pMD18-T Simple Vector (TaKaRa, Takara Biotechnology, Dalian, China) and chemically competent Escherichia coli (DH5α cells, TaKaRa), according to the manufacturer’s instructions. PCR products were sequenced with use of M13 forward and reverse primers.

    • All sequencing fragments were assembled using DNAStar software. The open reading frames of the verified genome sequences were predicted using Geneious (version 11.1.5) and annotated using the Conserved Domain Database. Sequence alignment of the COVID-19 virus with reference sequences was done with Mafft software (version 7.450). The SNPs of each sequence were defined as the site’s variant from the reference sequence.

    • The primers were designed in entire genome regions to obtain overlapping amplicons of approximately 1,000–1,200 bp leading to a list of 38 primer pairs. Meanwhile, 5’ and 3’ terminal sequencing primers were designed to obtain amplicons of 400–500 bp for sequencing (Table. 1).

    • Using DNAStar software all sequencing fragments were assembled, 2 complete sequences named WH19004-S and GX0002 were obtained from the clinical samples (Figure 1). Of which, WH19004-S(29896 nt) is consistent with WH19004-NGS (accession ID: EPI_ISL_402120), except that there are 2 variants in nucleotide (nt) 27,493 (T/C) and 28,253 (T/C) respectively and identified these positions as single nucleotide polymorphisms by alignment with a large number of COVID-19 genome sequences (Figure 2). Nt 27,493 located in ORF7a (amino acid position 34), T or C translated to different amino acid (Ser or Pro), while nt 28,253 in ORF8 (amino acid position 120), no changes in amino acid.

      Figure 1.  COVID-19 virus genome fragment amplification by RT-PCR. A: Schematic representation of the amplificatory fragments of the genome. B: Capillary electrophoresis profiles of RT-PCR products of the obtained partial fragment. a to k: RT-PCR products of the fragment 1–11; l to m: RT-PCR products of the end of 5’ and 3’ of the genome.
      Figure 2.  Sequence comparison and Sanger sequencing diagram of COVID-19 virus in this study. (A) Sequence alignment of 4 whole-length genomes of COVID-19 virus. (B) Sanger sequencing diagram of WH19004-S by reverse primers 29R and 30R, which shows the SNPs in ORF7 and ORF8 of WH19004-S.

      The GX0002 strain (accession ID: EPI_ISL_434534) was 29,892 nt in length, including a 5’ untranslated region (UTR) (nt 1 to 265), replicase complex open reading frame 1ab [ORF1ab] (nt 266 to 21,555), S gene (nt 21,563 to 25,384), ORF3a (nt 25,393 to 26,220), E gene (nt 26,245 to 26,472), M gene (nt 26,523 to 27,191), ORF6 (nt 27,202 to 27,387), ORF7a (nt 27,394 to 27,759), ORF7b (nt 27,756 to 27,887), ORF8 gene (nt 27,894 to 28,259), N gene (nt 28,274 to 29,533), ORF10 gene (nt 29,558 to 29,674), and 3’ UTR (nt 29,675 to 29,892). Compared with the reference strain (GenBank no. NC_045512), the GX0002 strain only has a nucleotide variant in nt 24,325 position (G/A) in the S gene and no changes in amino acid (Figure 2).

    • To accelerate our investigation of this virus and the disease it causes, a practical protocol for viral genome research of clinical samples is urgently needed. In this study, we obtained 2 COVID-19 virus complete genome sequences WH19004-S and GX0002 from clinical samples using the Sanger sequencing method.

      While NGS is the current mainstream sequencing method with the characteristics of high-throughput, rapidity, etc., it also has some drawbacks such as its relatively short reads. As a result, NGS lacks the capacity to link independent variations on the same nucleic molecule, so it is not well suited to discriminate and phase alleles to their respective parental homolog (9). In addition, the abundance of COVID-19 virus in clinical samples is often low, so the application of conventional NGS requires deeper sequencing of each sample in order to obtain sufficient coverage and depth of the whole viral genome, which increases the time and cost of sequencing. Nevertheless, as one of the earliest sequencing methods, the Sanger method has the characteristics of high accuracy, long reads, no requirement for expensive equipment, etc. Sanger sequencing has been used for analyzing genes where NGS fails to achieve sufficient depth of coverage or to generate data of high enough quality. Sanger sequencing is also used for confirming NGS variants before they are clinically reported (10). Especially when the general laboratory have common PCR machine and lack of expensive NGS platform, Sanger method is more prefer to be applied. In this study, we identified two SNPs in ORF7a (T/C, nt 27,493) and ORF8 (T/C, nt 28,253) of WH19004-S using Sanger sequencing compared with WH19004-NGS derived from NGS. The SNP in ORF7a of WH19004-S translated to two different amino acid (Ser or Pro). The roles of the SNPs in COVID-19 virus genetic evolution and whether it causes functional changes still need further investigation.

      In summary, we reported here a rapid, versatile, and clinic-friendly approach for sequencing the complete genome of COVID-19 virus from clinical samples using the Sanger method, which will facilitate monitoring of viral genetic variations during outbreaks, both current and future.

    • Conflict of interest: No conflicts of interest were reported.

    • Funding: This work was supported by the National Key Research and Development Program of China (2016YFD0500301).

Reference (10)




    DownLoad:  Full-Size Img  PowerPoint